FastA

FastA was one of the earliest widely used sequence database searching tools (Lipman 1985, Pearson & Lipman, 1988). It is still available and in use, but has been largely replaced by newer programs. However, the FastA format of representing a sequence and its name remain in use. When you retrieve a sequence or receive one from a sequencing facility, it will probably be in this format (an example is shown below).

>sequence name AGAATCCAAGCATACTCAGTCCAAGATTCTAAAAATGGCGGCTACTGCCGT