

Primers
An important component of PCR is the primer(s), which are short sequences of DNA (typically 10-30 base pairs long) that help initiate the synthesis process and also determine exactly which region(s) of DNA will be amplified.
Keep in mind that the primer sequences can be located anywhere along the template sequence, but must flank the key area of interest.
DNA template:
GCACTTAGCGTAATCGATCTAATGGCATGTGTACGATGCCGTA
Primer sequence:
CGTGAATCGCATTAGCTA

